Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102680
Name   oriT_pP10-2 in_silico
Organism   Staphylococcus aureus strain P10
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP039159 (2257..2445 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 132..138, 142..148  (GTCTGGC..GCCAGAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_pP10-2
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3124 GenBank   NZ_CP039159
Plasmid name   pP10-2 Incompatibility group   -
Plasmid size   2855 bp Coordinate of oriT [Strand]   2257..2445 [+]
Host baterium   Staphylococcus aureus strain P10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -