Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 102674
• Name: oriT_WH333|unnamed4
• Organism: Escherichia coli strain WH333
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_PSNS01000031 (5477..5536 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_WH333|unnamed4
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 3118
• GenBank: NZ_PSNS01000031
• Plasmid name: WH333|unnamed4
• Incompatibility group: ColRNAI
• Plasmid size: 6724 bp
• Coordinate of oriT [Strand]: 5477..5536 [+]
• Host baterium: Escherichia coli strain WH333

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -