Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102659 |
| Name | oriT_ATCC 35150_1|unnamed3  |
| Organism | Escherichia coli strain ATCC 35150_1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MBOI01000110 (458..532 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_ATCC 35150_1|unnamed3
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3103 | GenBank | NZ_MBOI01000110 |
| Plasmid name | ATCC 35150_1|unnamed3 | Incompatibility group | ColRNAI |
| Plasmid size | 3433 bp | Coordinate of oriT [Strand] | 458..532 [-] |
| Host baterium | Escherichia coli strain ATCC 35150_1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |