Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102654 |
| Name | oriT_Ec47VL|unnamed17  |
| Organism | Escherichia coli strain Ec47VL |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LYPE01000060 (889..963 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_Ec47VL|unnamed17
GTCGGGGCGAAGCCCTGACTAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCGAAGCCCTGACTAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3098 | GenBank | NZ_LYPE01000060 |
| Plasmid name | Ec47VL|unnamed17 | Incompatibility group | ColRNAI |
| Plasmid size | 3399 bp | Coordinate of oriT [Strand] | 889..963 [-] |
| Host baterium | Escherichia coli strain Ec47VL |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |