Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102644
Name   oriT_BL700|unnamed1 in_silico
Organism   Salmonella enterica subsp. enterica serovar Kentucky strain BL700
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JASCZH010000003 (3764..3823 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_BL700|unnamed1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3088 GenBank   NZ_JASCZH010000003
Plasmid name   BL700|unnamed1 Incompatibility group   ColRNAI
Plasmid size   4018 bp Coordinate of oriT [Strand]   3764..3823 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Kentucky strain BL700

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -