Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102636 |
| Name | oriT_pUMNturkey4_IncAC |
| Organism | Escherichia coli strain UMNturkey4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JRPZ01000079 (15471..15621 [+], 151 nt) |
| oriT length | 151 nt |
| IRs (inverted repeats) | 93..98, 106..111 (TGGCCT..AGGCCA) 12..17, 24..29 (AACCCT..AGGGTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 151 nt
>oriT_pUMNturkey4_IncAC
TGGTCGATGTGAACCCTTTCGACAGGGTTATGAATGAATTGAAAAGTCGTGGCCGCAAGAACGCTCACATCCTGAGCATCCTCCAATTCGACTGGCCTGCATCGGAGGCCATCATCGAGAAGCTGAGCTGCTACATCACAGACGGGATTAA
TGGTCGATGTGAACCCTTTCGACAGGGTTATGAATGAATTGAAAAGTCGTGGCCGCAAGAACGCTCACATCCTGAGCATCCTCCAATTCGACTGGCCTGCATCGGAGGCCATCATCGAGAAGCTGAGCTGCTACATCACAGACGGGATTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 15972..22645
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LS40_RS24295 (LS40_24280) | 11018..11674 | + | 657 | WP_000268552 | hypothetical protein | - |
| LS40_RS24300 (LS40_24285) | 11730..12347 | + | 618 | WP_000464630 | hypothetical protein | - |
| LS40_RS30665 (LS40_24290) | 12348..12554 | + | 207 | WP_000505706 | hypothetical protein | - |
| LS40_RS24310 (LS40_24295) | 12580..12858 | + | 279 | WP_000746034 | hypothetical protein | - |
| LS40_RS24315 (LS40_24300) | 12949..13437 | - | 489 | WP_000467110 | hypothetical protein | - |
| LS40_RS24320 (LS40_24305) | 13452..15056 | - | 1605 | Protein_21 | DNA topoisomerase | - |
| LS40_RS24325 (LS40_24310) | 15061..15420 | + | 360 | Protein_22 | TraM recognition domain-containing protein | - |
| LS40_RS24330 (LS40_24315) | 15470..16015 | + | 546 | WP_000228720 | hypothetical protein | - |
| LS40_RS24335 (LS40_24320) | 15972..16601 | + | 630 | WP_000743449 | DUF4400 domain-containing protein | tfc7 |
| LS40_RS24340 (LS40_24325) | 16611..17057 | + | 447 | WP_000122507 | hypothetical protein | - |
| LS40_RS24345 (LS40_24330) | 17067..17444 | + | 378 | WP_000869297 | hypothetical protein | - |
| LS40_RS24350 (LS40_24335) | 17444..18106 | + | 663 | WP_001231464 | hypothetical protein | - |
| LS40_RS29875 | 18287..18430 | + | 144 | WP_001275801 | hypothetical protein | - |
| LS40_RS24355 (LS40_24340) | 18442..18807 | + | 366 | WP_001052530 | hypothetical protein | - |
| LS40_RS24360 (LS40_24345) | 18952..19233 | + | 282 | WP_000805625 | type IV conjugative transfer system protein TraL | traL |
| LS40_RS24365 (LS40_24350) | 19230..19856 | + | 627 | WP_001049717 | TraE/TraK family type IV conjugative transfer system protein | traE |
| LS40_RS24370 (LS40_24355) | 19840..20757 | + | 918 | WP_000794249 | type-F conjugative transfer system secretin TraK | traK |
| LS40_RS24375 (LS40_24360) | 20757..22070 | + | 1314 | WP_024131605 | TraB/VirB10 family protein | traB |
| LS40_RS24380 (LS40_24365) | 22067..22645 | + | 579 | WP_000793435 | type IV conjugative transfer system lipoprotein TraV | traV |
| LS40_RS24385 (LS40_24370) | 22649..23041 | + | 393 | WP_000479535 | TraA family conjugative transfer protein | - |
| LS40_RS24390 (LS40_24375) | 23326..24588 | + | 1263 | WP_000608644 | IS1380-like element ISEcp1 family transposase | - |
| LS40_RS24400 (LS40_24385) | 24912..26057 | + | 1146 | WP_000976514 | extended-spectrum class C beta-lactamase CMY-2 | - |
| LS40_RS24405 (LS40_24390) | 26151..26684 | + | 534 | WP_001221666 | lipocalin family protein | - |
| LS40_RS24410 (LS40_24395) | 26681..26998 | - | 318 | WP_000118520 | quaternary ammonium compound efflux SMR transporter SugE | - |
| LS40_RS30670 | 27255..27620 | + | 366 | Protein_40 | LuxR family transcriptional regulator | - |
Host bacterium
| ID | 3080 | GenBank | NZ_JRPZ01000079 |
| Plasmid name | pUMNturkey4_IncAC | Incompatibility group | - |
| Plasmid size | 34634 bp | Coordinate of oriT [Strand] | 15471..15621 [+] |
| Host baterium | Escherichia coli strain UMNturkey4 |
Cargo genes
| Drug resistance gene | aph(6)-Id, aph(3'')-Ib, sul2, blaCMY-2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |