Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102627 |
| Name | oriT_pUMNturkey6_1  |
| Organism | Escherichia coli strain UMNturkey6 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JRQB01000010 (369..455 [+], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_pUMNturkey6_1
GGGGTGTCGGGGTGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGTGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3071 | GenBank | NZ_JRQB01000010 |
| Plasmid name | pUMNturkey6_1 | Incompatibility group | Col |
| Plasmid size | 1506 bp | Coordinate of oriT [Strand] | 369..455 [+] |
| Host baterium | Escherichia coli strain UMNturkey6 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |