Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102624 |
| Name | oriT_73-89|unnamed contig0101  |
| Organism | Escherichia coli strain 73-89 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LFJY01000101 (8389..8474 [-], 86 nt) |
| oriT length | 86 nt |
| IRs (inverted repeats) | 61..68, 73..80 (TTGGTGGT..ACCACCAA) 27..34, 37..44 (GCAAAAAC..GTTTTTGC) 8..13, 21..26 (TGATTT..AAATCA) |
| Location of nic site | 53..54 |
| Conserved sequence flanking the nic site |
GGTGTGGTGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 86 nt
>oriT_73-89|unnamed contig0101
AATTGCATGATTTAAAACACAAATCAGCAAAAACTTGTTTTTGCGTGGGGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
AATTGCATGATTTAAAACACAAATCAGCAAAAACTTGTTTTTGCGTGGGGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 7821..33654
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACM17_RS25300 (ACM17_25420) | 3106..3540 | + | 435 | WP_046201789 | conjugation system SOS inhibitor PsiB | - |
| ACM17_RS25305 (ACM17_25425) | 3537..4256 | + | 720 | WP_046201788 | plasmid SOS inhibition protein A | - |
| ACM17_RS25310 (ACM17_25430) | 4253..4567 | + | 315 | WP_000872077 | hypothetical protein | - |
| ACM17_RS30035 | 4716..4868 | + | 153 | Protein_7 | DUF5431 family protein | - |
| ACM17_RS25320 (ACM17_25440) | 4813..4935 | + | 123 | WP_223200913 | Hok/Gef family protein | - |
| ACM17_RS29475 | 5181..5540 | - | 360 | WP_077792862 | hypothetical protein | - |
| ACM17_RS25335 (ACM17_25455) | 5610..5816 | + | 207 | WP_046201787 | hypothetical protein | - |
| ACM17_RS25340 (ACM17_25460) | 5840..6142 | + | 303 | WP_046201786 | hypothetical protein | - |
| ACM17_RS25345 (ACM17_25465) | 6298..6585 | + | 288 | WP_046201785 | hypothetical protein | - |
| ACM17_RS25350 (ACM17_25470) | 6704..7525 | + | 822 | WP_046201784 | DUF932 domain-containing protein | - |
| ACM17_RS25355 (ACM17_25475) | 7821..8423 | - | 603 | WP_077787755 | transglycosylase SLT domain-containing protein | virB1 |
| ACM17_RS25360 (ACM17_25480) | 8746..9129 | + | 384 | WP_049590597 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| ACM17_RS25365 (ACM17_25485) | 9322..9975 | + | 654 | WP_046201782 | conjugal transfer protein TraJ | - |
| ACM17_RS28120 | 10100..10327 | + | 228 | WP_071886279 | conjugal transfer relaxosome protein TraY | - |
| ACM17_RS25370 (ACM17_25490) | 10360..10725 | + | 366 | WP_046201781 | type IV conjugative transfer system pilin TraA | - |
| ACM17_RS25375 (ACM17_25495) | 10740..11051 | + | 312 | WP_046201780 | type IV conjugative transfer system protein TraL | traL |
| ACM17_RS25380 (ACM17_25500) | 11073..11639 | + | 567 | WP_046201779 | type IV conjugative transfer system protein TraE | traE |
| ACM17_RS25385 (ACM17_25505) | 11626..12354 | + | 729 | WP_046201778 | type-F conjugative transfer system secretin TraK | traK |
| ACM17_RS25390 (ACM17_25510) | 12354..13802 | + | 1449 | WP_046201777 | F-type conjugal transfer pilus assembly protein TraB | traB |
| ACM17_RS25395 (ACM17_25515) | 13792..14352 | + | 561 | WP_046201776 | conjugal transfer pilus-stabilizing protein TraP | - |
| ACM17_RS25400 (ACM17_25520) | 14339..14660 | + | 322 | Protein_24 | conjugal transfer protein TrbD | - |
| ACM17_RS25405 (ACM17_25525) | 14653..14904 | + | 252 | WP_046201775 | conjugal transfer protein TrbG | - |
| ACM17_RS25410 (ACM17_25530) | 14901..15416 | + | 516 | WP_046201774 | type IV conjugative transfer system lipoprotein TraV | traV |
| ACM17_RS28125 (ACM17_25535) | 15551..15772 | + | 222 | WP_046201773 | conjugal transfer protein TraR | - |
| ACM17_RS25420 (ACM17_25540) | 15765..16178 | + | 414 | WP_046201772 | hypothetical protein | - |
| ACM17_RS25425 (ACM17_25545) | 16171..16644 | + | 474 | WP_046201771 | hypothetical protein | - |
| ACM17_RS25430 (ACM17_25550) | 16724..16942 | + | 219 | WP_046201770 | hypothetical protein | - |
| ACM17_RS29275 (ACM17_25555) | 16970..17317 | + | 348 | WP_046201769 | hypothetical protein | - |
| ACM17_RS25440 (ACM17_25560) | 17450..20080 | + | 2631 | WP_049590594 | type IV secretion system protein TraC | virb4 |
| ACM17_RS25445 (ACM17_25565) | 20077..20463 | + | 387 | WP_046201768 | type-F conjugative transfer system protein TrbI | - |
| ACM17_RS25450 (ACM17_25570) | 20460..21092 | + | 633 | WP_046201767 | type-F conjugative transfer system protein TraW | traW |
| ACM17_RS25455 (ACM17_25575) | 21089..22082 | + | 994 | Protein_35 | conjugal transfer pilus assembly protein TraU | - |
| ACM17_RS29280 | 22103..22282 | + | 180 | WP_058153243 | hypothetical protein | - |
| ACM17_RS25460 (ACM17_25580) | 22279..22518 | - | 240 | WP_001066128 | hypothetical protein | - |
| ACM17_RS25465 (ACM17_25585) | 22711..23349 | + | 639 | WP_046201765 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| ACM17_RS28130 | 23346..23717 | + | 372 | WP_071886277 | hypothetical protein | - |
| ACM17_RS25470 (ACM17_25590) | 23743..24165 | + | 423 | WP_046201764 | HNH endonuclease signature motif containing protein | - |
| ACM17_RS25475 (ACM17_25595) | 24162..25991 | + | 1830 | WP_046201763 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| ACM17_RS25480 (ACM17_25600) | 26018..26275 | + | 258 | WP_046201762 | conjugal transfer protein TrbE | - |
| ACM17_RS25485 (ACM17_25605) | 26268..27011 | + | 744 | WP_046201761 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| ACM17_RS25490 (ACM17_25610) | 27025..27390 | + | 366 | WP_021572669 | hypothetical protein | - |
| ACM17_RS25495 (ACM17_25615) | 27521..27922 | + | 402 | WP_244468206 | hypothetical protein | - |
| ACM17_RS25500 (ACM17_25620) | 27988..28269 | + | 282 | WP_046201759 | type-F conjugative transfer system pilin chaperone TraQ | - |
| ACM17_RS25505 (ACM17_25625) | 28256..28801 | + | 546 | WP_046201758 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| ACM17_RS28135 | 28791..29105 | + | 315 | WP_249405951 | P-type conjugative transfer protein TrbJ | - |
| ACM17_RS25510 (ACM17_25630) | 29059..29451 | + | 393 | WP_046201757 | F-type conjugal transfer protein TrbF | - |
| ACM17_RS25515 (ACM17_25635) | 29438..30811 | + | 1374 | WP_046201756 | conjugal transfer pilus assembly protein TraH | traH |
| ACM17_RS25520 (ACM17_25640) | 30808..33654 | + | 2847 | WP_049590596 | conjugal transfer mating-pair stabilization protein TraG | traG |
| ACM17_RS25525 (ACM17_25645) | 33651..34160 | + | 510 | WP_000628099 | conjugal transfer entry exclusion protein TraS | - |
| ACM17_RS25530 (ACM17_25650) | 34174..34905 | + | 732 | WP_046201754 | conjugal transfer complement resistance protein TraT | - |
Host bacterium
| ID | 3068 | GenBank | NZ_LFJY01000101 |
| Plasmid name | 73-89|unnamed contig0101 | Incompatibility group | - |
| Plasmid size | 35212 bp | Coordinate of oriT [Strand] | 8389..8474 [-] |
| Host baterium | Escherichia coli strain 73-89 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |