Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102620
Name   oriT_pUMNturkey5_5 in_silico
Organism   Escherichia coli strain UMNturkey5
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JRQA01000059 (3292..3351 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pUMNturkey5_5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3064 GenBank   NZ_JRQA01000059
Plasmid name   pUMNturkey5_5 Incompatibility group   ColRNAI
Plasmid size   5043 bp Coordinate of oriT [Strand]   3292..3351 [-]
Host baterium   Escherichia coli strain UMNturkey5

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -