Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102615
Name   oriT_pVZ321-thrLABC in_silico
Organism   Escherichia coli XH001
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AFYG01000108 (2761..2920 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pVZ321-thrLABC
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3059 GenBank   NZ_AFYG01000108
Plasmid name   pVZ321-thrLABC Incompatibility group   IncQ1
Plasmid size   16124 bp Coordinate of oriT [Strand]   2761..2920 [-]
Host baterium   Escherichia coli XH001

Cargo genes


Drug resistance gene   aph(3')-Ia, catA1
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -