Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102608
Name   oriT_S4_VPH_Chula|unnamed5 in_silico
Organism   Salmonella enterica strain S4_VPH_Chula
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JASBCJ010000033 (1616..1675 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_S4_VPH_Chula|unnamed5
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3052 GenBank   NZ_JASBCJ010000033
Plasmid name   S4_VPH_Chula|unnamed5 Incompatibility group   Col440I
Plasmid size   3830 bp Coordinate of oriT [Strand]   1616..1675 [-]
Host baterium   Salmonella enterica strain S4_VPH_Chula

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -