Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102604
Name   oriT_S3_VPH_Chula|unnamed1 in_silico
Organism   Salmonella enterica strain S3_VPH_Chula
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JASBCK010000004 (85475..85579 [+], 105 nt)
oriT length   105 nt
IRs (inverted repeats)      56..61, 74..79  (TGGAAT..ATTCCA)
 46..51, 56..61  (ATTCCA..TGGAAT)
 1..6, 8..13  (AATTTG..CAAATT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 105 nt

>oriT_S3_VPH_Chula|unnamed1
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3048 GenBank   NZ_JASBCK010000004
Plasmid name   S3_VPH_Chula|unnamed1 Incompatibility group   IncA/C2
Plasmid size   86420 bp Coordinate of oriT [Strand]   85475..85579 [+]
Host baterium   Salmonella enterica strain S3_VPH_Chula

Cargo genes


Drug resistance gene   aph(3')-Ia, floR, tet(A), aph(6)-Id, aph(3'')-Ib, sul2, blaTEM-1B
Virulence gene   -
Metal resistance gene   merE, merD
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -