Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102601 |
| Name | oriT_FWSEC0084|unnamed4  |
| Organism | Escherichia coli strain FWSEC0084 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RRFD01000228 (3067..3141 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | 37..43, 46..52 (CGCGCAT..ATGCGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_FWSEC0084|unnamed4
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGCGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGCGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 3045 | GenBank | NZ_RRFD01000228 |
| Plasmid name | FWSEC0084|unnamed4 | Incompatibility group | Col440I |
| Plasmid size | 3212 bp | Coordinate of oriT [Strand] | 3067..3141 [-] |
| Host baterium | Escherichia coli strain FWSEC0084 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |