Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102601 |
Name | oriT_FWSEC0084|unnamed4 |
Organism | Escherichia coli strain FWSEC0084 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_RRFD01000228 (3067..3141 [-], 75 nt) |
oriT length | 75 nt |
IRs (inverted repeats) | 37..43, 46..52 (CGCGCAT..ATGCGCG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_FWSEC0084|unnamed4
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGCGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGCGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 3045 | GenBank | NZ_RRFD01000228 |
Plasmid name | FWSEC0084|unnamed4 | Incompatibility group | Col440I |
Plasmid size | 3212 bp | Coordinate of oriT [Strand] | 3067..3141 [-] |
Host baterium | Escherichia coli strain FWSEC0084 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |