Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102596
Name   oriT_INSRALV892|unnamed in_silico
Organism   Morganella morganii strain INSRALV892
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LGYC01000043 (723..826 [-], 104 nt)
oriT length   104 nt
IRs (inverted repeats)      63..70, 73..80  (CACCATGC..GCATGGTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 104 nt

>oriT_INSRALV892|unnamed
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   3040 GenBank   NZ_LGYC01000043
Plasmid name   INSRALV892|unnamed Incompatibility group   -
Plasmid size   8575 bp Coordinate of oriT [Strand]   723..826 [-]
Host baterium   Morganella morganii strain INSRALV892

Cargo genes


Drug resistance gene   tet(Y), aph(6)-Id, aph(3'')-Ib
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -