Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102513 |
| Name | oriT_FWSEC0078|unnamed4  |
| Organism | Escherichia coli strain FWSEC0078 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RREX01000197 (2359..2481 [+], 123 nt) |
| oriT length | 123 nt |
| IRs (inverted repeats) | 90..98, 112..120 (AATAATGTA..TACATTATT) 38..45, 48..55 (GCAAAAAC..GTTTTTGC) 2..9, 14..21 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 123 nt
>oriT_FWSEC0078|unnamed4
GTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTGATTTGTTTTACATTATTAAA
GTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTGATTTGTTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2957 | GenBank | NZ_RREX01000197 |
| Plasmid name | FWSEC0078|unnamed4 | Incompatibility group | - |
| Plasmid size | 3623 bp | Coordinate of oriT [Strand] | 2359..2481 [+] |
| Host baterium | Escherichia coli strain FWSEC0078 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |