Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102510
Name   oriT_BMH-17-0036|unnamed4 in_silico
Organism   Escherichia coli strain BMH-17-0036
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAHMAA010000009 (436..495 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_BMH-17-0036|unnamed4
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2954 GenBank   NZ_JAHMAA010000009
Plasmid name   BMH-17-0036|unnamed4 Incompatibility group   ColRNAI
Plasmid size   6877 bp Coordinate of oriT [Strand]   436..495 [-]
Host baterium   Escherichia coli strain BMH-17-0036

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -