Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102500
Name   oriT_pCRKP-21_Vir in_silico
Organism   Klebsiella pneumoniae strain CRKP-21
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JANPXO010000002 (139650..139677 [+], 28 nt)
oriT length   28 nt
IRs (inverted repeats)      16..21, 23..28  (ATCAGA..TCTGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 28 nt

>oriT_pCRKP-21_Vir
AGTTTGGTGCTTATGATCAGAATCTGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2944 GenBank   NZ_JANPXO010000002
Plasmid name   pCRKP-21_Vir Incompatibility group   IncFIB
Plasmid size   198192 bp Coordinate of oriT [Strand]   139650..139677 [+]
Host baterium   Klebsiella pneumoniae strain CRKP-21

Cargo genes


Drug resistance gene   -
Virulence gene   rmpA, iucA, iucB, iucC, iutA
Metal resistance gene   pbrA, terE, terD, terC, terB, terA, terZ, terW
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -