Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102495 |
| Name | oriT_pCRKP-06_Res  |
| Organism | Klebsiella pneumoniae strain CRKP06 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JANPYK010000002 (109399..109448 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pCRKP-06_Res
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2939 | GenBank | NZ_JANPYK010000002 |
| Plasmid name | pCRKP-06_Res | Incompatibility group | IncFIB |
| Plasmid size | 135131 bp | Coordinate of oriT [Strand] | 109399..109448 [+] |
| Host baterium | Klebsiella pneumoniae strain CRKP06 |
Cargo genes
| Drug resistance gene | sitABCD, ant(3'')-Ia, blaCTX-M-14, qacE, cmlA1, catA2 |
| Virulence gene | iutA, iucC, iucB, iucA |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |