Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102481 |
| Name | oriT_pMR0713  |
| Organism | Escherichia coli strain MRSN22624 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JRKV01000089 (1558..1617 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pMR0713
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2925 | GenBank | NZ_JRKV01000089 |
| Plasmid name | pMR0713 | Incompatibility group | Col |
| Plasmid size | 1822 bp | Coordinate of oriT [Strand] | 1558..1617 [+] |
| Host baterium | Escherichia coli strain MRSN22624 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |