Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102479 |
Name | oriT_pMR0713 |
Organism | Escherichia coli strain MRSN22624 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JRKV01000057 (2478..2601 [-], 124 nt) |
oriT length | 124 nt |
IRs (inverted repeats) | 92..99, 113..120 (ATAATGTA..TACATTAT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_pMR0713
GGTTGGTGGTTCTCACCACCAAAAGCACCACACACTACGCAAAAACAAGTTTTTGCTGATTTGCTACTTGAATCATTAACTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATAAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACACTACGCAAAAACAAGTTTTTGCTGATTTGCTACTTGAATCATTAACTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATAAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2923 | GenBank | NZ_JRKV01000057 |
Plasmid name | pMR0713 | Incompatibility group | - |
Plasmid size | 5861 bp | Coordinate of oriT [Strand] | 2478..2601 [-] |
Host baterium | Escherichia coli strain MRSN22624 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |