Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102471
Name   oriT_pMR0713 in_silico
Organism   Escherichia coli strain MRSN17749
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JRKU01000046 (2478..2601 [-], 124 nt)
oriT length   124 nt
IRs (inverted repeats)      92..99, 113..120  (ATAATGTA..TACATTAT)
 90..95, 107..112  (AAATAA..TTATTT)
 39..46, 49..56  (GCAAAAAC..GTTTTTGC)
 3..10, 15..22  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 124 nt

>oriT_pMR0713
GGTTGGTGGTTCTCACCACCAAAAGCACCACACACTACGCAAAAACAAGTTTTTGCTGATTTGCTACTTGAATCATTAACTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATAAAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2915 GenBank   NZ_JRKU01000046
Plasmid name   pMR0713 Incompatibility group   -
Plasmid size   5861 bp Coordinate of oriT [Strand]   2478..2601 [-]
Host baterium   Escherichia coli strain MRSN17749

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -