Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102467
Name   oriT_S8_VPH_Chula|unnamed4 in_silico
Organism   Salmonella enterica strain S8_VPH_Chula
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JARVXA010000006 (731..1014 [-], 284 nt)
oriT length   284 nt
IRs (inverted repeats)      245..250, 253..258  (CGCCCC..GGGGCG)
 183..189, 197..203  (TATAAAA..TTTTATA)
 130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..37, 42..48  (GCAAAAA..TTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 284 nt

>oriT_S8_VPH_Chula|unnamed4
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTTATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2911 GenBank   NZ_JARVXA010000006
Plasmid name   S8_VPH_Chula|unnamed4 Incompatibility group   ColRNAI
Plasmid size   4223 bp Coordinate of oriT [Strand]   731..1014 [-]
Host baterium   Salmonella enterica strain S8_VPH_Chula

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -