Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102460
Name   oriT_145|unnamed7 in_silico
Organism   Klebsiella pneumoniae strain 145
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MAOO01000153 (3662..3712 [-], 51 nt)
oriT length   51 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 51 nt

>oriT_145|unnamed7
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2904 GenBank   NZ_MAOO01000153
Plasmid name   145|unnamed7 Incompatibility group   Col440I
Plasmid size   4421 bp Coordinate of oriT [Strand]   3662..3712 [-]
Host baterium   Klebsiella pneumoniae strain 145

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -