Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102457
Name   oriT_145|unnamed12 in_silico
Organism   Klebsiella pneumoniae strain 145
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MAOO01000033 (1198..1255 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_145|unnamed12
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2901 GenBank   NZ_MAOO01000033
Plasmid name   145|unnamed12 Incompatibility group   ColRNAI
Plasmid size   3457 bp Coordinate of oriT [Strand]   1198..1255 [-]
Host baterium   Klebsiella pneumoniae strain 145

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -