Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102457 |
| Name | oriT_145|unnamed12  |
| Organism | Klebsiella pneumoniae strain 145 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MAOO01000033 (1198..1255 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_145|unnamed12
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2901 | GenBank | NZ_MAOO01000033 |
| Plasmid name | 145|unnamed12 | Incompatibility group | ColRNAI |
| Plasmid size | 3457 bp | Coordinate of oriT [Strand] | 1198..1255 [-] |
| Host baterium | Klebsiella pneumoniae strain 145 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |