Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102453 |
| Name | oriT_196|unnamed2  |
| Organism | Klebsiella pneumoniae strain 196 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LZCZ01000009 (6984..7033 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_196|unnamed2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 6426..30721
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| A9Z47_RS08210 (A9Z47_08170) | 1443..1793 | + | 351 | WP_004152758 | hypothetical protein | - |
| A9Z47_RS08225 (A9Z47_08185) | 2429..2785 | + | 357 | WP_004152717 | hypothetical protein | - |
| A9Z47_RS08230 (A9Z47_08190) | 2846..3058 | + | 213 | WP_004152718 | hypothetical protein | - |
| A9Z47_RS08235 (A9Z47_08195) | 3069..3293 | + | 225 | WP_004152719 | hypothetical protein | - |
| A9Z47_RS08240 (A9Z47_08200) | 3374..3694 | + | 321 | WP_004152720 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| A9Z47_RS08245 (A9Z47_08205) | 3684..3962 | + | 279 | WP_004152721 | helix-turn-helix transcriptional regulator | - |
| A9Z47_RS08250 (A9Z47_08210) | 3963..4376 | + | 414 | WP_004152722 | helix-turn-helix domain-containing protein | - |
| A9Z47_RS08275 (A9Z47_08230) | 5210..6031 | + | 822 | WP_004178064 | DUF932 domain-containing protein | - |
| A9Z47_RS08280 (A9Z47_08235) | 6064..6393 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| A9Z47_RS08285 (A9Z47_08240) | 6426..6911 | - | 486 | WP_004178063 | transglycosylase SLT domain-containing protein | virB1 |
| A9Z47_RS08290 (A9Z47_08245) | 7345..7737 | + | 393 | WP_004178062 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| A9Z47_RS08295 (A9Z47_08250) | 7951..8646 | + | 696 | WP_004178061 | transcriptional regulator TraJ family protein | - |
| A9Z47_RS08300 (A9Z47_08255) | 8730..9101 | + | 372 | WP_004208838 | TraY domain-containing protein | - |
| A9Z47_RS08305 (A9Z47_08260) | 9155..9523 | + | 369 | WP_004178060 | type IV conjugative transfer system pilin TraA | - |
| A9Z47_RS08310 (A9Z47_08265) | 9537..9842 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| A9Z47_RS08315 (A9Z47_08270) | 9862..10428 | + | 567 | WP_004152602 | type IV conjugative transfer system protein TraE | traE |
| A9Z47_RS08320 (A9Z47_08275) | 10415..11155 | + | 741 | WP_004152601 | type-F conjugative transfer system secretin TraK | traK |
| A9Z47_RS08325 (A9Z47_08280) | 11155..12579 | + | 1425 | WP_004152600 | F-type conjugal transfer pilus assembly protein TraB | traB |
| A9Z47_RS08330 (A9Z47_08285) | 12572..13168 | + | 597 | WP_004152599 | conjugal transfer pilus-stabilizing protein TraP | - |
| A9Z47_RS08335 (A9Z47_08290) | 13191..13760 | + | 570 | WP_004152598 | type IV conjugative transfer system lipoprotein TraV | traV |
| A9Z47_RS08340 (A9Z47_08295) | 13892..14302 | + | 411 | WP_004152597 | lipase chaperone | - |
| A9Z47_RS08345 (A9Z47_08300) | 14307..14597 | + | 291 | WP_004152596 | hypothetical protein | - |
| A9Z47_RS08350 (A9Z47_08305) | 14621..14839 | + | 219 | WP_004171484 | hypothetical protein | - |
| A9Z47_RS08355 (A9Z47_08310) | 14840..15157 | + | 318 | WP_004152595 | hypothetical protein | - |
| A9Z47_RS08360 (A9Z47_08315) | 15224..15628 | + | 405 | WP_004152594 | hypothetical protein | - |
| A9Z47_RS08370 (A9Z47_08325) | 15924..16322 | + | 399 | WP_004153071 | hypothetical protein | - |
| A9Z47_RS08375 (A9Z47_08330) | 16394..19033 | + | 2640 | WP_004152592 | type IV secretion system protein TraC | virb4 |
| A9Z47_RS08380 (A9Z47_08335) | 19033..19422 | + | 390 | WP_004152591 | type-F conjugative transfer system protein TrbI | - |
| A9Z47_RS08385 (A9Z47_08340) | 19422..20048 | + | 627 | WP_004152590 | type-F conjugative transfer system protein TraW | traW |
| A9Z47_RS08390 (A9Z47_08345) | 20092..21051 | + | 960 | WP_015065634 | conjugal transfer pilus assembly protein TraU | traU |
| A9Z47_RS08395 (A9Z47_08350) | 21064..21702 | + | 639 | WP_004152682 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| A9Z47_RS08400 (A9Z47_08355) | 21750..23705 | + | 1956 | WP_004153093 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| A9Z47_RS08405 (A9Z47_08360) | 23737..23973 | + | 237 | WP_004152683 | conjugal transfer protein TrbE | - |
| A9Z47_RS29590 (A9Z47_08365) | 23970..24155 | + | 186 | WP_004152684 | hypothetical protein | - |
| A9Z47_RS08415 (A9Z47_08370) | 24201..24527 | + | 327 | WP_004152685 | hypothetical protein | - |
| A9Z47_RS08420 (A9Z47_08375) | 24548..25300 | + | 753 | WP_004152686 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| A9Z47_RS08425 (A9Z47_08380) | 25311..25550 | + | 240 | WP_004152687 | type-F conjugative transfer system pilin chaperone TraQ | - |
| A9Z47_RS08430 (A9Z47_08385) | 25522..26094 | + | 573 | WP_004152688 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| A9Z47_RS08435 (A9Z47_08390) | 26087..26515 | + | 429 | WP_004152689 | hypothetical protein | - |
| A9Z47_RS08440 (A9Z47_08395) | 26502..27872 | + | 1371 | WP_004178055 | conjugal transfer pilus assembly protein TraH | traH |
| A9Z47_RS08445 (A9Z47_08400) | 27872..30721 | + | 2850 | WP_004178054 | conjugal transfer mating-pair stabilization protein TraG | traG |
| A9Z47_RS08450 (A9Z47_08405) | 30727..31146 | + | 420 | Protein_44 | conjugal transfer protein TraS | - |
| A9Z47_RS08455 (A9Z47_08410) | 31161..31442 | - | 282 | Protein_45 | IS1-like element IS1A family transposase | - |
Host bacterium
| ID | 2897 | GenBank | NZ_LZCZ01000009 |
| Plasmid name | 196|unnamed2 | Incompatibility group | - |
| Plasmid size | 31442 bp | Coordinate of oriT [Strand] | 6984..7033 [-] |
| Host baterium | Klebsiella pneumoniae strain 196 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |