Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102447 |
| Name | oriT_SMG012F6|unnamed2  |
| Organism | Escherichia coli strain SMG012F6 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JALEBK010000028 (1988..2045 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_SMG012F6|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2891 | GenBank | NZ_JALEBK010000028 |
| Plasmid name | SMG012F6|unnamed2 | Incompatibility group | Col440I |
| Plasmid size | 3116 bp | Coordinate of oriT [Strand] | 1988..2045 [-] |
| Host baterium | Escherichia coli strain SMG012F6 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |