Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102440 |
| Name | oriT_p49141_Col  |
| Organism | Citrobacter freundii strain CF49141 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAFIQF010000005 (423..605 [+], 183 nt) |
| oriT length | 183 nt |
| IRs (inverted repeats) | 105..110, 115..120 (ACCCCC..GGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 183 nt
>oriT_p49141_Col
CCACCCGGTTATAACAGTACTATAAGTAGTTGTTTCTACCCCGATTTTGGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAAGCCATAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGTTATAACAGTACTATAAGTAGTTGTTTCTACCCCGATTTTGGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAAGCCATAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2884 | GenBank | NZ_JAFIQF010000005 |
| Plasmid name | p49141_Col | Incompatibility group | Col |
| Plasmid size | 2349 bp | Coordinate of oriT [Strand] | 423..605 [+] |
| Host baterium | Citrobacter freundii strain CF49141 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |