Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102440
Name   oriT_p49141_Col in_silico
Organism   Citrobacter freundii strain CF49141
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAFIQF010000005 (423..605 [+], 183 nt)
oriT length   183 nt
IRs (inverted repeats)      105..110, 115..120  (ACCCCC..GGGGGT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 183 nt

>oriT_p49141_Col
CCACCCGGTTATAACAGTACTATAAGTAGTTGTTTCTACCCCGATTTTGGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAAGCCATAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2884 GenBank   NZ_JAFIQF010000005
Plasmid name   p49141_Col Incompatibility group   Col
Plasmid size   2349 bp Coordinate of oriT [Strand]   423..605 [+]
Host baterium   Citrobacter freundii strain CF49141

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -