Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102438 |
| Name | oriT_p49583_Col  |
| Organism | Enterobacter hormaechei strain EC49583 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAFIQG010000003 (1934..1993 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_p49583_Col
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2882 | GenBank | NZ_JAFIQG010000003 |
| Plasmid name | p49583_Col | Incompatibility group | Col440I |
| Plasmid size | 4097 bp | Coordinate of oriT [Strand] | 1934..1993 [-] |
| Host baterium | Enterobacter hormaechei strain EC49583 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |