Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102435
Name   oriT_p45182_Col4401 in_silico
Organism   Klebsiella michiganensis strain KO45182
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAFIQE010000008 (2694..2744 [+], 51 nt)
oriT length   51 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 51 nt

>oriT_p45182_Col4401
AATCTGCAAATTTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2879 GenBank   NZ_JAFIQE010000008
Plasmid name   p45182_Col4401 Incompatibility group   Col440I
Plasmid size   4763 bp Coordinate of oriT [Strand]   2694..2744 [+]
Host baterium   Klebsiella michiganensis strain KO45182

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -