Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102424
Name   oriT_B9S22|unnamed2 in_silico
Organism   Escherichia coli strain B9S22
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_QEMQ01000076 (4220..4279 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_B9S22|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2868 GenBank   NZ_QEMQ01000076
Plasmid name   B9S22|unnamed2 Incompatibility group   Col440II
Plasmid size   4323 bp Coordinate of oriT [Strand]   4220..4279 [-]
Host baterium   Escherichia coli strain B9S22

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -