Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102408 |
Name | oriT_Res13-Abat-PEA24-P1-01|unnamed98 |
Organism | Enterobacter roggenkampii strain Res13-Abat-PEA24-P1-01 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JADAJY010000052 (3588..3647 [-], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_Res13-Abat-PEA24-P1-01|unnamed98
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2852 | GenBank | NZ_JADAJY010000052 |
Plasmid name | Res13-Abat-PEA24-P1-01|unnamed98 | Incompatibility group | ColRNAI |
Plasmid size | 6814 bp | Coordinate of oriT [Strand] | 3588..3647 [-] |
Host baterium | Enterobacter roggenkampii strain Res13-Abat-PEA24-P1-01 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |