Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102408
Name   oriT_Res13-Abat-PEA24-P1-01|unnamed98 in_silico
Organism   Enterobacter roggenkampii strain Res13-Abat-PEA24-P1-01
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JADAJY010000052 (3588..3647 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_Res13-Abat-PEA24-P1-01|unnamed98
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2852 GenBank   NZ_JADAJY010000052
Plasmid name   Res13-Abat-PEA24-P1-01|unnamed98 Incompatibility group   ColRNAI
Plasmid size   6814 bp Coordinate of oriT [Strand]   3588..3647 [-]
Host baterium   Enterobacter roggenkampii strain Res13-Abat-PEA24-P1-01

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -