Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102400
Name   oriT_FWSEC0053|unnamed1 in_silico
Organism   Escherichia coli strain FWSEC0053
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRDZ01000199 (2790..2849 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FWSEC0053|unnamed1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGAAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2844 GenBank   NZ_RRDZ01000199
Plasmid name   FWSEC0053|unnamed1 Incompatibility group   ColRNAI
Plasmid size   5756 bp Coordinate of oriT [Strand]   2790..2849 [+]
Host baterium   Escherichia coli strain FWSEC0053

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -