Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102384 |
| Name | oriT_pHTP1  |
| Organism | Enterobacter kobei strain INTEC_BI4_1.1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JACSEP010000136 (766..822 [+], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pHTP1
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2828 | GenBank | NZ_JACSEP010000136 |
| Plasmid name | pHTP1 | Incompatibility group | Col440I |
| Plasmid size | 2699 bp | Coordinate of oriT [Strand] | 766..822 [+] |
| Host baterium | Enterobacter kobei strain INTEC_BI4_1.1 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |