Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102380 |
| Name | oriT_B10|unnamed scaffold_51  |
| Organism | Klebsiella pneumoniae strain B10 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LJCC01000052 (1172..1227 [-], 56 nt) |
| oriT length | 56 nt |
| IRs (inverted repeats) | 29..36, 39..46 (CACAGCGT..ACGCTGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 56 nt
>oriT_B10|unnamed scaffold_51
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2824 | GenBank | NZ_LJCC01000052 |
| Plasmid name | B10|unnamed scaffold_51 | Incompatibility group | ColRNAI |
| Plasmid size | 5834 bp | Coordinate of oriT [Strand] | 1172..1227 [-] |
| Host baterium | Klebsiella pneumoniae strain B10 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |