Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102376 |
Name | oriT_Res13-Abat-PEA21-P1-01|unnamed111_tig2 |
Organism | Enterobacter roggenkampii strain Res13-Abat-PEA21-P1-01 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JADAJH010000069 (2367..2426 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_Res13-Abat-PEA21-P1-01|unnamed111_tig2
GGGTTTCGGGGCGCTGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCTGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2820 | GenBank | NZ_JADAJH010000069 |
Plasmid name | Res13-Abat-PEA21-P1-01|unnamed111_tig2 | Incompatibility group | Col440II |
Plasmid size | 4741 bp | Coordinate of oriT [Strand] | 2367..2426 [+] |
Host baterium | Enterobacter roggenkampii strain Res13-Abat-PEA21-P1-01 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |