Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102375
Name   oriT_pCol440II in_silico
Organism   Klebsiella pneumoniae strain BA31746
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JACWMP010000042 (392..449 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pCol440II
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2819 GenBank   NZ_JACWMP010000042
Plasmid name   pCol440II Incompatibility group   Col440II
Plasmid size   4167 bp Coordinate of oriT [Strand]   392..449 [+]
Host baterium   Klebsiella pneumoniae strain BA31746

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -