Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102366
Name   oriT_R1|unnamed2 in_silico
Organism   Pantoea agglomerans strain R1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_WSSS01000018 (5524..5683 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_R1|unnamed2
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2810 GenBank   NZ_WSSS01000018
Plasmid name   R1|unnamed2 Incompatibility group   IncQ1
Plasmid size   8401 bp Coordinate of oriT [Strand]   5524..5683 [-]
Host baterium   Pantoea agglomerans strain R1

Cargo genes


Drug resistance gene   aph(3')-IIa
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -