Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102363 |
| Name | oriT_Res13-Croi-PEB01-41|unnamednovel_0  |
| Organism | Escherichia fergusonii strain Res13-Croi-PEB01-41 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JADAID010000138 (754..813 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_Res13-Croi-PEB01-41|unnamednovel_0
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2807 | GenBank | NZ_JADAID010000138 |
| Plasmid name | Res13-Croi-PEB01-41|unnamednovel_0 | Incompatibility group | Col440I |
| Plasmid size | 3830 bp | Coordinate of oriT [Strand] | 754..813 [-] |
| Host baterium | Escherichia fergusonii strain Res13-Croi-PEB01-41 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |