Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102360
Name   oriT_Res13-Croi-PEB01-41|unnamed414 in_silico
Organism   Escherichia fergusonii strain Res13-Croi-PEB01-41
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JADAID010000131 (251..323 [-], 73 nt)
oriT length   73 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 73 nt

>oriT_Res13-Croi-PEB01-41|unnamed414
GTCGGGGTGAAGCCCTGACCAGGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2804 GenBank   NZ_JADAID010000131
Plasmid name   Res13-Croi-PEB01-41|unnamed414 Incompatibility group   Col
Plasmid size   1546 bp Coordinate of oriT [Strand]   251..323 [-]
Host baterium   Escherichia fergusonii strain Res13-Croi-PEB01-41

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -