Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102359
Name   oriT_Res13-Croi-PEB01-41|unnamed23 in_silico
Organism   Escherichia fergusonii strain Res13-Croi-PEB01-41
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JADAID010000130 (2386..2445 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_Res13-Croi-PEB01-41|unnamed23
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2803 GenBank   NZ_JADAID010000130
Plasmid name   Res13-Croi-PEB01-41|unnamed23 Incompatibility group   ColRNAI
Plasmid size   6669 bp Coordinate of oriT [Strand]   2386..2445 [-]
Host baterium   Escherichia fergusonii strain Res13-Croi-PEB01-41

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -