Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102349 |
| Name | oriT_pIncFIB_K  |
| Organism | Klebsiella quasipneumoniae strain KP2014c46 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_WJHX01000050 (2308..2357 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pIncFIB_K
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1750..26846
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FXO16_RS18105 | 534..1355 | + | 822 | WP_004182076 | DUF932 domain-containing protein | - |
| FXO16_RS18110 | 1388..1717 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| FXO16_RS18115 | 1750..2235 | - | 486 | WP_004178063 | transglycosylase SLT domain-containing protein | virB1 |
| FXO16_RS18120 | 2626..3042 | + | 417 | WP_072145360 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| FXO16_RS18125 | 3242..3961 | + | 720 | WP_074195844 | conjugal transfer protein TrbJ | - |
| FXO16_RS18130 | 4094..4300 | + | 207 | WP_172436862 | TraY domain-containing protein | - |
| FXO16_RS18135 | 4362..4730 | + | 369 | WP_004194426 | type IV conjugative transfer system pilin TraA | - |
| FXO16_RS18140 | 4744..5049 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| FXO16_RS18145 | 5069..5635 | + | 567 | WP_016831035 | type IV conjugative transfer system protein TraE | traE |
| FXO16_RS18150 | 5622..6362 | + | 741 | WP_040167378 | type-F conjugative transfer system secretin TraK | traK |
| FXO16_RS18155 | 6362..7786 | + | 1425 | WP_064185728 | F-type conjugal transfer pilus assembly protein TraB | traB |
| FXO16_RS18165 | 7779..8375 | + | 597 | Protein_11 | conjugal transfer pilus-stabilizing protein TraP | - |
| FXO16_RS18170 | 8398..8982 | + | 585 | WP_014386196 | type IV conjugative transfer system lipoprotein TraV | traV |
| FXO16_RS18175 | 9114..9524 | + | 411 | WP_080789281 | hypothetical protein | - |
| FXO16_RS18180 | 9529..9818 | + | 290 | Protein_14 | hypothetical protein | - |
| FXO16_RS18185 | 9842..10060 | + | 219 | WP_080789280 | hypothetical protein | - |
| FXO16_RS18190 | 10061..10372 | + | 312 | WP_080789279 | hypothetical protein | - |
| FXO16_RS18195 | 10439..10843 | + | 405 | WP_016831042 | hypothetical protein | - |
| FXO16_RS18200 | 10886..11275 | + | 390 | WP_023158009 | hypothetical protein | - |
| FXO16_RS18205 | 11283..11681 | + | 399 | WP_023158008 | hypothetical protein | - |
| FXO16_RS18210 | 11753..14392 | + | 2640 | WP_016831045 | type IV secretion system protein TraC | virb4 |
| FXO16_RS18215 | 14392..14781 | + | 390 | WP_004167468 | type-F conjugative transfer system protein TrbI | - |
| FXO16_RS18220 | 14781..15416 | + | 636 | WP_020325113 | type-F conjugative transfer system protein TraW | traW |
| FXO16_RS18225 | 15451..15852 | + | 402 | WP_016831047 | hypothetical protein | - |
| FXO16_RS18230 | 15849..16838 | + | 990 | WP_015632509 | conjugal transfer pilus assembly protein TraU | traU |
| FXO16_RS18235 | 16859..17035 | + | 177 | WP_162866177 | hypothetical protein | - |
| FXO16_RS18240 | 17114..17761 | + | 648 | WP_016831049 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| FXO16_RS18245 | 17820..19775 | + | 1956 | WP_024623124 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| FXO16_RS18250 | 19807..20061 | + | 255 | WP_080789278 | conjugal transfer protein TrbE | - |
| FXO16_RS18255 | 20039..20287 | + | 249 | WP_004152675 | hypothetical protein | - |
| FXO16_RS18260 | 20300..20626 | + | 327 | WP_016831051 | hypothetical protein | - |
| FXO16_RS18265 | 20647..21399 | + | 753 | WP_004152677 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| FXO16_RS18270 | 21410..21649 | + | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| FXO16_RS18275 | 21621..22178 | + | 558 | WP_004152678 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| FXO16_RS18280 | 22224..22667 | + | 444 | WP_016831053 | F-type conjugal transfer protein TrbF | - |
| FXO16_RS18285 | 22645..24024 | + | 1380 | WP_072159542 | conjugal transfer pilus assembly protein TraH | traH |
| FXO16_RS18290 | 24024..26846 | + | 2823 | WP_064185726 | conjugal transfer mating-pair stabilization protein TraG | traG |
Host bacterium
| ID | 2793 | GenBank | NZ_WJHX01000050 |
| Plasmid name | pIncFIB_K | Incompatibility group | - |
| Plasmid size | 26865 bp | Coordinate of oriT [Strand] | 2308..2357 [-] |
| Host baterium | Klebsiella quasipneumoniae strain KP2014c46 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |