Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102347
Name   oriT_p20ES-42 in_silico
Organism   Enterobacter cloacae strain 20ES
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_PEHU01000018 (1559..1653 [+], 95 nt)
oriT length   95 nt
IRs (inverted repeats)      73..78, 85..90  (AAAAAA..TTTTTT)
 73..78, 84..89  (AAAAAA..TTTTTT)
 27..34, 37..44  (AGCGTGAT..ATCACGCT)
 13..19, 31..37  (TAAATCA..TGATTTA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 95 nt

>oriT_p20ES-42
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2791 GenBank   NZ_PEHU01000018
Plasmid name   p20ES-42 Incompatibility group   IncFIA
Plasmid size   41575 bp Coordinate of oriT [Strand]   1559..1653 [+]
Host baterium   Enterobacter cloacae strain 20ES

Cargo genes


Drug resistance gene   blaTEM-1B
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -