Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102341 |
Name | oriT_p9M_2 |
Organism | Pectobacterium zantedeschiae strain 9M |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_NWTM01000013 (2111..2168 [+], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p9M_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2785 | GenBank | NZ_NWTM01000013 |
Plasmid name | p9M_2 | Incompatibility group | Col440II |
Plasmid size | 3222 bp | Coordinate of oriT [Strand] | 2111..2168 [+] |
Host baterium | Pectobacterium zantedeschiae strain 9M |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |