Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102327 |
Name | oriT_pBEH5 |
Organism | Priestia endophytica strain 3631_9D |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_LVYL01000009 (6256..6295 [+], 40 nt) |
oriT length | 40 nt |
IRs (inverted repeats) | 14..21, 28..35 (AAAGTATA..TATACTTT) 2..8, 12..18 (ACTTTTG..CAAAAGT) |
Location of nic site | 26..27 |
Conserved sequence flanking the nic site |
GTGTGTTATA |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 40 nt
>oriT_pBEH5
CACTTTTGGAACAAAAGTATAGTGTGTTATACTTTACATG
CACTTTTGGAACAAAAGTATAGTGTGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2771 | GenBank | NZ_LVYL01000009 |
Plasmid name | pBEH5 | Incompatibility group | - |
Plasmid size | 9136 bp | Coordinate of oriT [Strand] | 6256..6295 [+] |
Host baterium | Priestia endophytica strain 3631_9D |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |