Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102327
Name   oriT_pBEH5 in_silico
Organism   Priestia endophytica strain 3631_9D
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LVYL01000009 (6256..6295 [+], 40 nt)
oriT length   40 nt
IRs (inverted repeats)      14..21, 28..35  (AAAGTATA..TATACTTT)
 2..8, 12..18  (ACTTTTG..CAAAAGT)
Location of nic site      26..27
Conserved sequence flanking the
  nic site  
 
 GTGTGTTATA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 40 nt

>oriT_pBEH5
CACTTTTGGAACAAAAGTATAGTGTGTTATACTTTACATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2771 GenBank   NZ_LVYL01000009
Plasmid name   pBEH5 Incompatibility group   -
Plasmid size   9136 bp Coordinate of oriT [Strand]   6256..6295 [+]
Host baterium   Priestia endophytica strain 3631_9D

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -