Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102327 |
| Name | oriT_pBEH5  |
| Organism | Priestia endophytica strain 3631_9D |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LVYL01000009 (6256..6295 [+], 40 nt) |
| oriT length | 40 nt |
| IRs (inverted repeats) | 14..21, 28..35 (AAAGTATA..TATACTTT) 2..8, 12..18 (ACTTTTG..CAAAAGT) |
| Location of nic site | 26..27 |
| Conserved sequence flanking the nic site |
GTGTGTTATA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 40 nt
>oriT_pBEH5
CACTTTTGGAACAAAAGTATAGTGTGTTATACTTTACATG
CACTTTTGGAACAAAAGTATAGTGTGTTATACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2771 | GenBank | NZ_LVYL01000009 |
| Plasmid name | pBEH5 | Incompatibility group | - |
| Plasmid size | 9136 bp | Coordinate of oriT [Strand] | 6256..6295 [+] |
| Host baterium | Priestia endophytica strain 3631_9D |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |