Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102322
Name   oriT_FWSEC0536|unnamed5 in_silico
Organism   Escherichia coli strain FWSEC0536
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRSC01000253 (2672..2955 [+], 284 nt)
oriT length   284 nt
IRs (inverted repeats)      245..250, 253..258  (CGCCCC..GGGGCG)
 184..189, 197..202  (ATAAAA..TTTTAT)
 130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..37, 42..48  (GCAAAAA..TTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 284 nt

>oriT_FWSEC0536|unnamed5
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTACAGGACGCCCCTGGGGGCGCTGCTAGGGGTGTCTGTTCAGATATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2766 GenBank   NZ_RRSC01000253
Plasmid name   FWSEC0536|unnamed5 Incompatibility group   ColRNAI
Plasmid size   4794 bp Coordinate of oriT [Strand]   2672..2955 [+]
Host baterium   Escherichia coli strain FWSEC0536

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -