Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102317 |
| Name | oriT_KPC89|unnamed P83  |
| Organism | Klebsiella pneumoniae strain KPC89 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_QXGQ01000036 (2165..2216 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_KPC89|unnamed P83
AAATCTGCAAATTTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AAATCTGCAAATTTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2761 | GenBank | NZ_QXGQ01000036 |
| Plasmid name | KPC89|unnamed P83 | Incompatibility group | - |
| Plasmid size | 3304 bp | Coordinate of oriT [Strand] | 2165..2216 [+] |
| Host baterium | Klebsiella pneumoniae strain KPC89 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |