Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102313 |
| Name | oriT1_B29|unnamed P60a  |
| Organism | Klebsiella pneumoniae strain B29 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NTHW02000077 ( 1071..1128 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT1_B29|unnamed P60a
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2757 | GenBank | NZ_NTHW02000077 |
| Plasmid name | B29|unnamed P60a | Incompatibility group | Col440I |
| Plasmid size | 4301 bp | Coordinate of oriT [Strand] | 4060..4117 [-]; 1071..1128 [-] |
| Host baterium | Klebsiella pneumoniae strain B29 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |