Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102313
Name   oriT1_B29|unnamed P60a in_silico
Organism   Klebsiella pneumoniae strain B29
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_NTHW02000077 ( 1071..1128 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT1_B29|unnamed P60a
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2757 GenBank   NZ_NTHW02000077
Plasmid name   B29|unnamed P60a Incompatibility group   Col440I
Plasmid size   4301 bp Coordinate of oriT [Strand]   4060..4117 [-]; 1071..1128 [-]
Host baterium   Klebsiella pneumoniae strain B29

Cargo genes


Drug resistance gene   qnrB19
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -