Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102310
Name   oriT_B29|unnamed P10a in_silico
Organism   Klebsiella pneumoniae strain B29
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_NTHW02000062 (2589..2748 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_B29|unnamed P10a
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2754 GenBank   NZ_NTHW02000062
Plasmid name   B29|unnamed P10a Incompatibility group   IncQ1
Plasmid size   7149 bp Coordinate of oriT [Strand]   2589..2748 [-]
Host baterium   Klebsiella pneumoniae strain B29

Cargo genes


Drug resistance gene   aph(3')-VIa
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -