Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102306 |
| Name | oriT_KPN_KPC_HUG_01|p1  |
| Organism | Klebsiella pneumoniae strain KPN_KPC_HUG_01 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_QRAC01000107 (15..64 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_KPN_KPC_HUG_01|p1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2750 | GenBank | NZ_QRAC01000107 |
| Plasmid name | KPN_KPC_HUG_01|p1 | Incompatibility group | - |
| Plasmid size | 792 bp | Coordinate of oriT [Strand] | 15..64 [-] |
| Host baterium | Klebsiella pneumoniae strain KPN_KPC_HUG_01 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |