Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102302
Name   oriT_NRL 08/001|unnamed in_silico
Organism   Staphylococcus aureus strain NRL 08/001
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_VHNE01000020 (1392..1580 [-], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 132..138, 142..148  (GTCTGGC..GCCAGAC)
 71..76, 88..93  (AAAAGT..ACTTTT)
 64..71, 76..83  (GTGTCACA..TGTGACAC)
 33..39, 44..50  (TGTCACA..TGTGACA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_NRL 08/001|unnamed
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACAAGCGCAATATATTGTGTCACAAAAGTGTGACACTACAACTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2746 GenBank   NZ_VHNE01000020
Plasmid name   NRL 08/001|unnamed Incompatibility group   -
Plasmid size   2956 bp Coordinate of oriT [Strand]   1392..1580 [-]
Host baterium   Staphylococcus aureus strain NRL 08/001

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -